SARS-CoV-2 Genome

From GM-RKB
(Redirected from SARS-CoV-2 genome)
Jump to navigation Jump to search

A SARS-CoV-2 Genome is an RNA viral genome that can produce a SARS-CoV-2 Virus.



References

2020

  • https://nytimes.com/interactive/2020/04/03/science/coronavirus-genome-bad-news-wrapped-in-protein.html
    • QUOTE: ... A virus is “simply a piece of bad news wrapped up in protein,” the biologists Jean and Peter Medawar wrote in 1977. In January, scientists deciphered a piece of very bad news: the genome of SARS-CoV-2, the virus that causes Covid-19. ... Viruses must hijack living cells to replicate and spread. When the coronavirus finds a suitable cell, it injects a strand of RNA that contains the entire coronavirus genome.

      The genome of the new coronavirus is less than 30,000 “letters” long. (The human genome is over 3 billion.) Scientists have identified genes for as many as 29 proteins, which carry out a range of jobs from making copies of the coronavirus to suppressing the body’s immune responses.

      The first sequence of RNA letters reads:
      auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag

      This sequence recruits machinery inside the infected cell to read the RNA letters — a, c, g and u — and translate them into coronavirus proteins. ...

SARS-CoV-2 Genome illustration

.